While the ubiquitin system is involved in many aspects of cellular processes, this chapter focuses on the ubiquitin-mediated degradation of ion channels and transporters. Thus, the tight regulation of these transmembrane proteins is essential for cell physiology. Their dysfunction underlies the pathology of various diseases. Ion channels and transporters play essential roles in excitable cells including cardiac, skeletal, and smooth muscle cells, neurons, and endocrine cells. This study was supported by Marie Curie Research Fellowship (QLGA-CT-2001-52014), the Deutsche Forschungsgemeinschaft (La315/4-4/La315/5-1), and the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (Center for Interdisciplinary Clinical Research) 01 KS 9602. Noll and the meticulous preparation of the manuscript by T. The authors acknowledge the technical assistance of B. Phosphorylation-dependent events have previously been Acknowledgments This additional mechanism might be phosphorylation and thereby inhibition of the ubiquitin ligase Nedd4-2. This effect does not require ClC-2 phosphorylation at 82Ser suggesting the presence of an additional mechanism by which the kinases modulate ClC-2. The channel is upregulated by the protein kinases SGK1-3 and the related protein kinase B. The present observations disclose a novel mechanism in the regulation of the chloride channel ClC-2. The related constitutively active Discussion Two-electrode voltage clamp analysis of Xenopus oocytes expressing ClC-2 chloride channels revealed a hyperpolarization activated chloride current of −459.85 ± 62.70 nA ( n = 72) at −120 mV while water injected oocytes showed a non-voltage-activated background current of −31.97 ± 3.88 nA ( n = 11) at the same potential. The hemagglutinin (HA)-tagged ClC-2 was Results The following primers were used: S82A s: 5′ gtcgcatttgtgctgtacgctgccac 3′ S82A as: 5′ gtggcagcgtacagcacaaatgcgac 3′ S82D s: 5′ gtcgcatttgtgatgtacgctgccac 3′, and S82D as: 5′ gtggcagcgtacatcacaaatgcgac 3′. The mutated ClC-2 channels S82AClC-2 and S82DClC-2 were generated by site-directed mutagenesis (QuikChange site-directed mutagenesis kit, Stratagene, Heidelberg, Germany) according to the manufacturer’s instructions. These observations suggest that SGK1-3 and Nedd4-2 regulate ClC-2 at least in part by modulating ClC-2 abundance at the plasma membrane. According to chemiluminescence ClC-2 membrane abundance was enhanced by SGKs and diminished by Nedd4-2. ClC-2 activity decreased upon Nedd4-2 coexpression, an effect reversed by the kinases. Therefore, the role of Nedd4-2 in ClC-2 modulation was investigated. SGKs can phosphorylate the ubiquitin ligase Nedd4-2 and prevent Nedd4-2 from binding to its target. The stimulatory effect was still present upon disruption of the SGK phosphorylation site. ClC-2 expression in Xenopus oocytes induced inwardly rectifying currents that increased upon coexpression of SGK1-3 and the related kinase PKB. Thus, the present study explored whether ClC-2 is regulated by those kinases. The ClC-2 sequence contains a consensus site (Ser82) for phosphorylation by the serum and glucocorticoid inducible kinase isoforms SGK1-3. ClC-2 participates in the regulation of neuronal excitability, chloride secretion, and cell volume.
0 Comments
Leave a Reply. |
Details
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |